SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


antitoxin, antagonist for [protein|2E5A557E417CB355331CC0555D46A79793EB90B3|EndoA]
10.41 kDa
protein length
gene length
282 bp Sequence Blast
inhibition of [protein|2E5A557E417CB355331CC0555D46A79793EB90B3|EndoA]

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.17|Toxins, antitoxins and immunity against toxins] → [category|SW|Type 2 TA systems]
  • Gene

    518,657 518,938

    The protein

    Protein family

  • mazE/ndoAI family (single member, according to UniProt)
  • Structure

  • [PDB|4ME7] ([protein|2E5A557E417CB355331CC0555D46A79793EB90B3|NdoA]-[protein|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|NdoAI] complex) [Pubmed|24120662]
  • Expression and Regulation



    additional information

  • An [ncRNA|search|antisense RNA] is predicted for '[protein|search|ndoA]' [PubMed|20525796]
  • view in new tab

    view in new tab

    Biological materials


  • BKE04650 ([gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAAAACATACACCTCCAC, downstream forward: _UP4_CGCTTAGTCAGCGGAGGATA
  • BKK04650 ([gene|052BD59112DBE2F1DAC9DA5A7B0EA8DAF8D6FC47|ndoAI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACCCCTTTTTCTCAATTG, downstream forward: _UP4_TAACCGCCAAAGGCCAAACA
  • References

  • 17416361,15882409,24120662,23736285