SubtiBank SubtiBank
yecA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yecA

similar to L-methionine and branched chain amino acids transporter
locus
BSU_06550
pI
8.91
mw
49.66 kDa
protein length
424 aa Sequence Blast
gene length
1275 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.12|Other transporters]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    712,019 713,293

    The protein

    Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, corresponds to aa 35 ... 317, 23% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Biological materials

    Mutant

  • GP3039 Δ[gene|04FE8A07424F1FEFA7611BA4421087ED42E2D460|yecA]::''cat'', available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • MGNA-A909 (yecA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/909 NBRP B. subtilis, Japan]
  • BKE06550 ([gene|04FE8A07424F1FEFA7611BA4421087ED42E2D460|yecA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCCCCTCTCTGAT, downstream forward: _UP4_GTTTTGTGATCAAGCTTTTC
  • BKK06550 ([gene|04FE8A07424F1FEFA7611BA4421087ED42E2D460|yecA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGCCCCCTCTCTGAT, downstream forward: _UP4_GTTTTGTGATCAAGCTTTTC
  • References

  • 26319875,29416041