SubtiBank SubtiBank
yhdW
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yhdW

similar to glycerophosphodiester phosphodiesterase
locus
BSU_09620
pI
9.54
mw
27.33 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.2|Utilization of phospholipids/ based on similarity]
  • Gene

    Coordinates
    1,037,688 1,038,419

    The protein

    Catalyzed reaction/ biological activity

  • sn-glycero-3-phosphoester + H2O --> alcohol + H+ + sn-glycerol 3-phosphate (according to UniProt)
  • Protein family

  • glycerophosphoryl diester phosphodiesterase family (with [protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ], according to UniProt)
  • Paralogous protein(s)

  • [protein|AF37A0E08AAAA9159DD1F0183A61713EF582E830|YqiK], [protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ]
  • [SW|Domains]

  • GP-PDE domain (aa 1-238) (according to UniProt)
  • Structure

  • [PDB|5T9B] ([protein|E9BEF368F8E55888AD4849E8906E517831A882DF|GlpQ], 38% identity) [pubmed|27780866]
  • Expression and Regulation

    Operons

    genes
    [gene|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW]-[gene|BD1C4D9E6E8960DF77EE1571A637929C2D8C4A28|yhdV]-[gene|2F86A2FF36ED00DB0A9A91B064EBD095F5E759ED|fluC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B487 (yhdW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1486 NBRP B. subtilis, Japan]
  • BKE09620 ([gene|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTAAGTCAGCTCCTCG, downstream forward: _UP4_GATTTCATCATAAAGGATGG
  • BKK09620 ([gene|04CACAF4F786090AB67D7C606C944F07B7A7FE55|yhdW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09620 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGCTAAGTCAGCTCCTCG, downstream forward: _UP4_GATTTCATCATAAAGGATGG
  • References

    Research papers

  • 27780866