SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


methionine [SW|ABC transporter] (binding lipoprotein)
30.20 kDa
protein length
274 aa Sequence Blast
gene length
825 bp Sequence Blast
methionine uptake
methionine [SW|ABC transporter] (binding lipoprotein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of methionine/ S-adenosylmethionine]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,361,767 3,362,591

    The protein

    Protein family

  • nlpA lipoprotein family (with [protein|9BFC99C85F7BEA5FEA6B8E82D205EED02375240E|YhcJ], according to UniProt)
  • Paralogous protein(s)

  • [protein|9BFC99C85F7BEA5FEA6B8E82D205EED02375240E|YhcJ]
  • Structure

  • [PDB|4GOT]
  • [SW|Localization]

  • associated to the cell membrane, via [protein|F94070DD039A422055FFC35087FB87765F22E156|MetP] [Pubmed|10092453,18763711]
  • extracellular (signal peptide) [Pubmed|18957862], lipid modification as retention signal
  • Expression and Regulation



    regulatory mechanism

  • [regulon|S-box|S-box]: transcription termination/ antitermination, the [SW|S-box] [SW|riboswitch] binds S-adenosylmethionine resulting in termination, in [regulon|S-box|S-box]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • activated during growth in the presence of branched chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [Pubmed|12618455]
  • the mRNA is processed between [gene|F94070DD039A422055FFC35087FB87765F22E156|metP] and [gene|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|metQ] by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y], this requires the [protein|EE52DFA35B935E551871D079A9BE877DB2001A3B|YmcA]-[protein|6C9A092F38739A3759793EF8B496569CD02C2E3F|YlbF]-[protein|EBD15C174A03B7FCDFFE4C5DB5D86E93F1B9CAC4|YaaT] complex [Pubmed|29794222]
  • the [SW|S-box] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials


  • MGNA-A595 (yusA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32730 ([gene|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|metQ]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGCTTTTTCAATGTAAATC, downstream forward: _UP4_TAAGACTGAAACCCCGGATG
  • BKK32730 ([gene|0481A9C134A6EEC6F111AD0C03E2E345D6A315A0|metQ]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGCTTTTTCAATGTAAATC, downstream forward: _UP4_TAAGACTGAAACCCCGGATG
  • References

  • 10092453,14990259,12618455,18957862,18763711,10094622,18039762,23038252,29794222