SubtiBank SubtiBank
degS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

degS

two-component sensor kinase for exoenzyme and competence regulation, kinase activity is activated in response to inhibition of flagellar rotation
locus
BSU35500
pI
5.99
mw
44.80 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
function
regulation of degradative enzyme and genetic competence
product
two-component sensor kinase
essential
no
synonyms
sacU

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    Coordinates
    3,645,379 3,646,536

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, autodephosphorylation, phosphorylation of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] on Asp-56 [Pubmed|1901568]
  • [SW|Domains]

  • aa 12 ... 170: unknown DegS domain
  • aa 180 ... 248: HisKA_3 domain (autophosphorylation)
  • aa 289 ... 384: HATPase_c
  • Modification

  • phosphorylation on Ser-76 [Pubmed|17218307], this stimulates phosphotransfer from His-189 to [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|21304896], the phosphorylyation is performed by [protein|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|PrkD] ''in vitro'' [Pubmed|21304896]
  • autophosphorylation on His-189
  • Effectors of protein activity

  • [protein|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|DegQ] (stimulation of autophosphorylation) [Pubmed|21965392]
  • inhibition of flagellar rotation stimulates kinase activity [Pubmed|23888912]
  • Structure

  • [PDB|3GIG] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK], corresponds to the HisKA_3 and HATPase_c domains, 28% identity) [pubmed|19805278]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation

    Operons

    genes
    [gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]-[gene|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]
    description
    [Pubmed|1688843]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1688843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|18502860], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|23123903], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|24317403], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|23123903]
  • view in new tab

    Biological materials

    Mutant

  • BKE35500 ([gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCCCTCCGTCACG, downstream forward: _UP4_TGACTATGATTTGTAAAATA
  • BKK35500 ([gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCCCTCCGTCACG, downstream forward: _UP4_TGACTATGATTTGTAAAATA
  • labs

  • [SW|Tarek Msadek], Institut Pasteur, Paris, France
  • References

    Reviews

  • 23927648
  • Original Publications

  • 17850253,12471443,14563871,1459944,1901568,10094672,1688843,16479537,17218307,21304896,21965392,24296669,23888912,25433860,19805278