SubtiBank SubtiBank


two-component sensor kinase for exoenzyme and competence regulation, kinase activity is activated in response to inhibition of flagellar rotation
44.80 kDa
protein length
385 aa Sequence Blast
gene length
1158 bp Sequence Blast
regulation of degradative enzyme and genetic competence
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    3,645,379 3,646,536

    Phenotypes of a mutant

  • the mutation suppresses the mucoid phenotype of ''[gene|86C729C7D5ABEE519ADC4A893940600BBB655EF1|motA]'' or ''[gene|FE56753D061344B0F10A6523F49C5C7356AA40B6|motB]'' mutants due to loss of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] phosphorylation and concomitant reduced expression of the ''[gene|86C05126ADBA22BB1771B1FA3D214B2E7A36311E|capB]-[gene|D66994D077D1382B88FF65075E44C2A31089548F|capC]-[gene|A696434A086A428D411CAF45B37CD8F82AC2503F|capA]-[gene|6B61DCE8D27776EBF942621D3AE90F410FD13F37|capE]'' operon [Pubmed|24296669]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, autodephosphorylation, phosphorylation of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] on Asp-56 [Pubmed|1901568]
  • ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
  • [SW|Domains]

  • aa 12 ... 170: unknown DegS domain
  • [SW|Histidine kinase domain] (aa 183-385) (according to UniProt)
  • aa 289 ... 384: HATPase_c
  • Modification

  • phosphorylation on Ser-76 [Pubmed|17218307], this stimulates phosphotransfer from His-189 to [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU] [Pubmed|21304896], the phosphorylyation is performed by [protein|E0097A00C82136BB0B1FB89FBA177E28A4EC3D54|PrkD] ''in vitro'' [Pubmed|21304896]
  • autophosphorylation on His-189
  • Effectors of protein activity

  • [protein|40C1E81BAB04BD1CC98FC57DF25D27DBDFEB5A59|DegQ] (stimulation of autophosphorylation) [Pubmed|21965392]
  • inhibition of flagellar rotation stimulates kinase activity [Pubmed|23888912]
  • Structure

  • [PDB|3GIG] ([protein|C5F9A1970393625B01C05C72C9A240C8EE8789D3|DesK], corresponds to the HisKA_3 and HATPase_c domains, 28% identity) [pubmed|19805278]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1688843], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|18502860], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: activation, [Pubmed|23123903], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|24317403], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • regulation

  • induced by glucose ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|23123903]
  • view in new tab

    Biological materials


  • BKE35500 ([gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCCCTCCGTCACG, downstream forward: _UP4_TGACTATGATTTGTAAAATA
  • BKK35500 ([gene|047CE33C0CC127DAD15D68D63843DF89F93ED3BF|degS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTCCCTCCGTCACG, downstream forward: _UP4_TGACTATGATTTGTAAAATA
  • labs

  • [SW|Tarek Msadek], Institut Pasteur, Paris, France
  • References


  • 23927648
  • Original Publications

  • 17850253,12471443,14563871,1459944,1901568,10094672,1688843,16479537,17218307,21304896,21965392,24296669,23888912,25433860,19805278