SubtiBank SubtiBank
rnr
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rnr

RNase R, required for protection against paraquate stress
locus
BSU_33610
pI
5.70
mw
88.56 kDa
protein length
779 aa Sequence Blast
gene length
2340 bp Sequence Blast
function
nonspecific degradation of rRNA
product
exoribonuclease RNase R (EC 3.1.-.-)
essential
no
synonyms
yvaJ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.5|Biosynthesis/ acquisition of nucleotides/ other]
  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.4|RNases] → [category|SW 3.2.4.1|Exoribonucleases]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    3,451,863 3,454,202

    The protein

    Catalyzed reaction/ biological activity

  • 3'-5'-exoribonuclease
  • Exonucleolytic cleavage in the 3'- to 5'-direction to yield nucleoside 5'-phosphates (according to UniProt)
  • Protein family

  • RNR ribonuclease family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|S1 domain] (aa 625 ... 708) (according to the Interpro database)
  • Structure

  • [PDB|5XGU] (from E. coli, 40% identity) [pubmed|29036353]
  • Expression and Regulation

    Operons

    genes
    [gene|D8851F453E5EF18D36F25834A8CB9C61EAF15E44|secG]-[gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    genes
    [gene|C0B6520E74CE9F7EE3DEC8C0D83E0770F241C4E8|yvaK]-[gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]-[gene|D19519B5A776D6E8EC2BFE7A7D67469CA0A6459A|smpB]-[gene|5C12BB19B975F7FEBCFA119DAC66338C20FCECFA|ssrA]
    description
    [Pubmed|17369301]

    regulation

  • ''[protein|search|yvaK]'': induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A495 (yvaJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/495 NBRP B. subtilis, Japan]
  • BKE33610 ([gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATTATCCGACCTCCTG, downstream forward: _UP4_TAGCAGCTCAACCAGCAAAT
  • BKK33610 ([gene|0472A4346ADA1DC41C9D00E8F3222A0EBB76DFA8|rnr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATTATCCGACCTCCTG, downstream forward: _UP4_TAGCAGCTCAACCAGCAAAT
  • labs

  • [SW|David Bechhofer], Mount Sinai School, New York, USA [http://www.mountsinai.org/Research/Centers%20Laboratories%20and%20Programs/Bechhofer%20Laboratory?citype=Physician&ciid=Bechhofer%20David%20H%201255565 Homepage]
  • References

    Reviews

  • 25878039,30340785
  • Original publications

  • 15805528,15805522,20360175,17369301,23529473,22582280,29873764,29036353