SubtiBank SubtiBank
trpC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

trpC

indole-3-glycerol-phosphate synthase
locus
BSU_22660
pI
5.53
mw
27.69 kDa
protein length
250 aa Sequence Blast
gene length
750 bp Sequence Blast
function
biosynthesis of tryptophan
product
indole-3-glycerol-phosphate synthase
essential
no
ec
4.1.1.48
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.13|Biosynthesis/ acquisition of aromatic amino acids]
  • Gene

    Coordinates
    2,374,139 → 2,374,888

    The protein

    Catalyzed reaction/ biological activity

  • 1-(2-carboxyphenylamino)-1-deoxy-D-ribulose 5-phosphate + H+ --> (1S,2R)-1-C-(indol-3-yl)glycerol 3-phosphate + CO2 + H2O (according to UniProt)
  • Protein family

  • TrpC family (single member, according to UniProt)
  • Structure

  • [PDB|1VC4] (from ''Thermus thermophilus'', 36% identity, 49% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    genes
    [gene|48C33A96F3B446440D4D9A86AA07AA3BA244063D|trpE]-[gene|4CD2A930753175B7F533EA6B91478577CE80A29C|trpD]-[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]-[gene|C6872585F9BD3717A4F49E96F7684C4A5AD1760D|trpF]-[gene|AEB1F4E28C5B2AFC7FCF65721D4D1A70D6FC38EE|trpB]-[gene|155FE26C148F7022948DD7539533AB6876571862|trpA]-[gene|4D7D62B4CDA350DCDC04E6934B5E23ECE4C57870|hisC]-[gene|DEB8358CE34F80560BE91F036659EF2C67A19623|tyrA]-[gene|CA00DFB480CBDC8AC31559958EF8E97E1E9BD4E1|aroE]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]: termination/antitermination, [pubmed|1551827], in [regulon|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB regulon]
  • regulation

  • not expressed if tryptophan is available ([protein|E030E80134E9DED6ADBC73C7C7435024CDFD38B9|MtrB]) [Pubmed|1551827]
  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • BKE22660 (Δ[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE22660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCAAGCATAGATCTCTTC, downstream forward: _UP4_CATGCTTTGTTTAGGGAGTG
  • BKK22660 (Δ[gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK22660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTTCAAGCATAGATCTCTTC, downstream forward: _UP4_CATGCTTTGTTTAGGGAGTG
  • References

    Reviews

  • 12966138
  • Original publications

  • 14976255,3924737,6436812,2422155,8419914,1551827,21815947