SubtiBank SubtiBank
bglS [2019-09-30 10:14:50]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

bglS [2019-09-30 10:14:50]

endo-beta-1,3-1,4 glucanase
27.12 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
lichenan degradation
endo-beta-1,3-1,4 glucanase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of other polymeric carbohydrates]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    4,011,842 4,012,570

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of (1->4)-beta-D-glucosidic linkages in beta-D-glucans containing (1->3)- and (1->4)-bonds (according to UniProt)
  • Protein family

  • glycosyl hydrolase 16 family (single member, according to UniProt)
  • Structure

  • [PDB|3O5S]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8606172], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|8245831], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT]: antitermination, via binding to an [SW|RNA switch], in [regulon|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|LicT regulon]
  • regulation

  • expressed in the stationary phase (temporal activation) [Pubmed|8245830]
  • view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8606172], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulation

  • expressed in the stationary phase (temporal activation) [Pubmed|8245830]
  • view in new tab

    view in new tab

    Biological materials


  • GP427 ([gene|FAC682CCD66056A8CBB9AE5F4BF51C1AADEBBD2C|licT]-[gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::erm), BGW7 (cat), both available in [SW|Jörg Stülke]'s lab
  • BKE39070 ([gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGGCATTCCCCTTTC, downstream forward: _UP4_TAATGCCAAATGTGAAAGAG
  • BKK39070 ([gene|044A0EBC8798B110E719B73664EB80F53112D8DE|bglS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGGCATTCCCCTTTC, downstream forward: _UP4_TAATGCCAAATGTGAAAGAG
  • References

  • 18957862,12850135,6087283,8245830,8245831,8606172,23459129,24391357,24659048,25808979,28084659,28235843,30733736