SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


9.47 kDa
protein length
gene length
261 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    3,727,427 3,727,687

    Expression and Regulation




  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    Biological materials


  • MGNA-A584 (ywqI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36200 ([gene|04376B3166B591132CE37D1DE85B0ECFEC6902EF|ywqI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTAATTTCTGACATAAAAA, downstream forward: _UP4_AAATAGAACAGAAAGGGCAG
  • BKK36200 ([gene|04376B3166B591132CE37D1DE85B0ECFEC6902EF|ywqI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTAATTTCTGACATAAAAA, downstream forward: _UP4_AAATAGAACAGAAAGGGCAG
  • References

  • 22383849