SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcriptional regulator ([SW|ArsR family])
25.47 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    585,868 586,548

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 1-92) (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C146 (ydfF::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE05390 ([gene|0405FF18AEB2DC3632CFFF25E82EFA08D0A48F57|ydfF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTTCCTCCTTACAT, downstream forward: _UP4_TAGGATTTTGAAGCGGAAAC
  • BKK05390 ([gene|0405FF18AEB2DC3632CFFF25E82EFA08D0A48F57|ydfF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTTCCTCCTTACAT, downstream forward: _UP4_TAGGATTTTGAAGCGGAAAC
  • References

  • 23504016