SubtiBank SubtiBank
ydfF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydfF

similar to transcriptional regulator ([SW|ArsR family])
locus
BSU_05390
pI
10.02
mw
25.47 kDa
protein length
226 aa Sequence Blast
gene length
681 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    585,868 586,548

    The protein

    Protein family

  • [SW|ArsR family]
  • [SW|Domains]

  • [SW|HTH arsR-type domain] (aa 1-92) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|0405FF18AEB2DC3632CFFF25E82EFA08D0A48F57|ydfF]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C146 (ydfF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2144 NBRP B. subtilis, Japan]
  • BKE05390 ([gene|0405FF18AEB2DC3632CFFF25E82EFA08D0A48F57|ydfF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTTCCTCCTTACAT, downstream forward: _UP4_TAGGATTTTGAAGCGGAAAC
  • BKK05390 ([gene|0405FF18AEB2DC3632CFFF25E82EFA08D0A48F57|ydfF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTTTCCTCCTTACAT, downstream forward: _UP4_TAGGATTTTGAAGCGGAAAC
  • References

  • 23504016