SubtiBank SubtiBank
katE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

katE

catalase, general stress protein
locus
BSU_39050
pI
5.84
mw
77.31 kDa
protein length
686 aa Sequence Blast
gene length
2061 bp Sequence Blast
function
detoxification (degradation) of hydrogen peroxide
product
catalase 2
essential
no
synonyms
katB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    4,008,143 4,010,203

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 --> O2 + 2 H2O (according to UniProt)
  • Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|KatA], [protein|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|KatX]
  • Structure

  • [PDB|1IPH] (from E. coli, 53% identity) [pubmed|7663946]
  • Expression and Regulation

    Operons

    genes
    [gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]-[gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|7559348,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B724 (katE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1723 NBRP B. subtilis, Japan]
  • BKE39050 ([gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCTCCCCCTTTTT, downstream forward: _UP4_TGATCGGCTCCTGTATCTTT
  • BKK39050 ([gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCTCCCCCTTTTT, downstream forward: _UP4_TGATCGGCTCCTGTATCTTT
  • References

  • 9393707,7559348,16672620,8931328,11544224,7663946