SubtiBank SubtiBank
katE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

katE

catalase, general stress protein
locus
BSU39050
pI
5.84
mw
77.31 kDa
protein length
686 aa Sequence Blast
gene length
2061 bp Sequence Blast
function
detoxification (degradation) of hydrogen peroxide
product
catalase 2
essential
no
synonyms
katB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    4,008,143 4,010,203

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 = O2 + 2 H2O (according to Swiss-Prot)
  • Protein family

  • HPII subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|KatA], [protein|DA5EB526EE8AF41BE9B837F2C276432BC4183AA1|KatX]
  • Structure

  • [PDB|1IPH] (from E. coli, 53% identity) [pubmed|7663946]
  • Expression and Regulation

    Operons

    genes
    [gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]-[gene|A647A29CAEA5D7188A08868A4397B4DF8A575710|yxiS]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|7559348,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B724 (katE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1723 NBRP B. subtilis, Japan]
  • BKE39050 ([gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCTCCCCCTTTTT, downstream forward: _UP4_TGATCGGCTCCTGTATCTTT
  • BKK39050 ([gene|03FE63D6AAC77D6CEB052D0BF578ACD048C772FB|katE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39050 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCTGCTCCCCCTTTTT, downstream forward: _UP4_TGATCGGCTCCTGTATCTTT
  • References

  • 9393707,7559348,16672620,8931328,11544224,7663946