SubtiBank SubtiBank
speA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

speA

arginine decarboxylase, required for [SW|biofilm formation]
locus
BSU_14630
pI
5.08
mw
53.42 kDa
protein length
490 aa Sequence Blast
gene length
1470 bp Sequence Blast
function
spermidine, polyamine biosynthesis
product
arginine decarboxylase
essential
no
ec
4.1.1.19
synonyms
cad

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.6|Metabolism of polyamines]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    1,534,279 → 1,535,751

    Phenotypes of a mutant

  • no [SW|biofilm formation] [Pubmed|24529384,20876533]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + L-arginine --> agmatine + CO2 (according to UniProt)
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (together with [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|YaaO]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|YaaO]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2X3L] (from Staphylococcus aureus, 28% identity) [pubmed|20419351]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • CS210 (''[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG, downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
  • BKK14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG, downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
  • References

  • 24529384,19255484,9723923,20876533,27197833,20419351