SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


arginine decarboxylase, required for [SW|biofilm formation]
53.42 kDa
protein length
490 aa Sequence Blast
gene length
1470 bp Sequence Blast
spermidine, polyamine biosynthesis
arginine decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Metabolism of polyamines]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    1,534,279 → 1,535,751

    Phenotypes of a mutant

  • no [SW|biofilm formation] [Pubmed|24529384,20876533]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + L-arginine --> agmatine + CO2 (according to UniProt)
  • Protein family

  • Orn/Lys/Arg decarboxylase class-I family (together with [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|YaaO]) (according to UniProt)
  • Paralogous protein(s)

  • [protein|EEF3E572ED2F23581EB9B48D16B3112B886F7975|YaaO]
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|2X3L] (from Staphylococcus aureus, 28% identity) [pubmed|20419351]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • CS210 (''[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]''::''aphA3'', available in [SW|Colin Harwood]'s and [SW|Jörg Stülke]'s labs) [Pubmed|27197833]
  • BKE14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG, downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
  • BKK14630 (Δ[gene|03E5E41FD7ADA4E9CB70E312FA5F163331C92695|speA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTTTTCCCACCTTTG, downstream forward: _UP4_TAAAAAATAAAAAGCATGCG
  • References

  • 24529384,19255484,9723923,20876533,27197833,20419351