SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


molybdopterin molybdenumtransferase
46.46 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
nitrate respiration
molybdopterin molybdenumtransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of molybdopterin]
  • Gene

    1,497,192 1,498,484

    The protein

    Catalyzed reaction/ biological activity

  • adenylyl-molybdopterin + H+ + molybdate --> AMP + H2O + Mo-molybdopterin (according to UniProt)
  • Protein family

  • MoeA family (single member, according to UniProt)
  • Structure

  • [PDB|1T3E] (from rat, 35% identity)
  • Expression and Regulation


    view in new tab

    Biological materials


  • BKE14280 ([gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCATTCTGACCCCTCCTG, downstream forward: _UP4_ATCAGAGAAGAGAATGGAAG
  • BKK14280 ([gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCATTCTGACCCCTCCTG, downstream forward: _UP4_ATCAGAGAAGAGAATGGAAG
  • References


  • 23539623
  • Original publications

  • 22383849