SubtiBank SubtiBank
moeA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

moeA

molybdopterin molybdenumtransferase
locus
BSU_14280
pI
5.61
mw
46.46 kDa
protein length
430 aa Sequence Blast
gene length
1293 bp Sequence Blast
function
nitrate respiration
product
molybdopterin molybdenumtransferase
essential
no
ec
2.10.1.1
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.10|Biosynthesis of molybdopterin]
  • Gene

    Coordinates
    1,497,192 1,498,484

    The protein

    Catalyzed reaction/ biological activity

  • adenylyl-molybdopterin + H+ + molybdate --> AMP + H2O + Mo-molybdopterin (according to UniProt)
  • Protein family

  • MoeA family (single member, according to UniProt)
  • Structure

  • [PDB|1T3E] (from rat, 35% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|C6DB8499752ED1DBF276C0E46CC561450BED6A40|mobA]-[gene|C163CF34BAA3A37DCC67851DEE5889BB7AD208AB|moeB]-[gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]-[gene|A283C34375EDF495940E2F03C4FB6A9FE841FA1E|mobB]-[gene|12F27FA4DB8232B52271565C4F4937520A4F5C7B|moaE]-[gene|5C3EAEE1287FFB1541A31B31A8B6627E60A4D2EB|moaD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE14280 ([gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCATTCTGACCCCTCCTG, downstream forward: _UP4_ATCAGAGAAGAGAATGGAAG
  • BKK14280 ([gene|03DBD906E31D6A8A4D14C9E2DACF0F1AB9F8DAA8|moeA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14280 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAGCATTCTGACCCCTCCTG, downstream forward: _UP4_ATCAGAGAAGAGAATGGAAG
  • References

    Reviews

  • 23539623
  • Original publications

  • 22383849