SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ATP-dependent DNA helicase
105.83 kDa
protein length
931 aa Sequence Blast
gene length
2796 bp Sequence Blast
response to DNA damage
ATP-dependent DNA helicase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • Gene

    2,349,671 2,352,466

    The protein

    Protein family

  • [SW|helicase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0F9B77CE6C662D2F249C7E33E5C553A74C390259|YpvA]
  • [SW|Domains]

  • [SW|Exonuclease domain] (aa 7-162) (according to UniProt)
  • [SW|Helicase ATP-binding domain] (aa 250-510) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 741-897) (according to UniProt)
  • Structure

  • [PDB|4A15] (from Thermoplasma acidophilum, corresponds to aa 257 ... 913 of DinG, 22% identity) [pubmed|22081108]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Biological materials


  • MGNA-A423 (dinG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22400 ([gene|03BFD8AD2E3D95858752F46366F6C2028D709029|dinG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATGGACACCTCAA, downstream forward: _UP4_TAAAAGCCGCATAAAGCGGC
  • BKK22400 ([gene|03BFD8AD2E3D95858752F46366F6C2028D709029|dinG]::kan trpC2) available at [ BGSC] and in [SW|Jörg Stülke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATTAAAATGGACACCTCAA, downstream forward: _UP4_TAAAAGCCGCATAAAGCGGC
  • References

  • 16479537,22081108