SubtiBank SubtiBank
cspR
The papers of the month are back! Check them out! Link here

cspR

similar to tRNA (Um34/Cm34) methyltransferase
locus
BSU08930
pI
6.05
mw
18.44 kDa
protein length
160 aa Sequence Blast
gene length
480 bp Sequence Blast
function
translation
product
tRNA (Um34/Cm34) methyltransferase homolog
essential
no
ec
2.1.1.-
synonyms
ygaR, trmL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    Coordinates
    970,135 → 970,617

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • catalyzes the methyl transfer from S-adenosyl-L-methionine to tRNA(Leu)(CAA) and tRNA(Leu)(UAA) isoacceptors [Pubmed|23804755]
  • Structure

  • [PDB|4JAK] (from ''E. coli'', 45% identity, 72% similarity) [Pubmed|23804755]
  • Expression and Regulation

    Operons

    genes
    [gene|506BD8F55C235CCCF5045073AEC93D8B1E4FB8DF|yhbB]-[gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • ''[SW|yhbB]-[SW|cspR]'': expressed in the mother cell early during [SW|sporulation] ([SW|SigE]) [Pubmed|12662922]
  • view in new tab

    genes
    [gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]
    description
    [Pubmed|22383849]

    regulation

  • ''[SW|yhbB]-[SW|cspR]'': expressed in the mother cell early during [SW|sporulation] ([SW|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials

    Mutant

  • BKE08930 (Δ[gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCTGTTTTTCTTATCC, downstream forward: _UP4_TAGTGAAAAACCCGCTCATC
  • BKK08930 (Δ[gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCTGTTTTTCTTATCC, downstream forward: _UP4_TAGTGAAAAACCCGCTCATC
  • References

  • 23804755,12662922,22383849,28189581