SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to tRNA (Um34/Cm34) methyltransferase
18.44 kDa
protein length
160 aa Sequence Blast
gene length
483 bp Sequence Blast
tRNA (Um34/Cm34) methyltransferase homolog

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|tRNA modification and maturation]
  • Gene

    970,135 970,617

    Phenotypes of a mutant

  • essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
  • The protein

    Catalyzed reaction/ biological activity

  • catalyzes the methyl transfer from S-adenosyl-L-methionine to tRNA(Leu)(CAA) and tRNA(Leu)(UAA) isoacceptors [Pubmed|23804755]
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|4JAK] (from ''E. coli'', 45% identity, 72% similarity) [Pubmed|23804755]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • ''[SW|yhbB]-[SW|cspR]'': expressed in the mother cell early during [SW|sporulation] ([SW|SigE]) [Pubmed|12662922]
  • view in new tab



  • ''[SW|yhbB]-[SW|cspR]'': expressed in the mother cell early during [SW|sporulation] ([SW|SigE]) [Pubmed|12662922]
  • view in new tab

    Biological materials


  • BKE08930 ([gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCTGTTTTTCTTATCC, downstream forward: _UP4_TAGTGAAAAACCCGCTCATC
  • BKK08930 ([gene|03BA7AEE17739689D632A35D9C3329EA0982C98A|cspR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTCTGTTTTTCTTATCC, downstream forward: _UP4_TAGTGAAAAACCCGCTCATC
  • References

  • 23804755,12662922,22383849,28189581