SubtiBank SubtiBank
lnrJ [2019-06-06 09:45:09]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lnrJ [2019-06-06 09:45:09]

two-component sensor kinase, involved in resistance to linearmycin
locus
BSU08290
pI
6.39
mw
44.38 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
involved in resistance to linearmycin
product
two-component sensor kinase
essential
no
synonyms
yfiJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    903,811 905,013

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK]
  • [SW|Domains]

  • 5 transmembrane segments
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]-[gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]
    description
    [Pubmed|8973323]
    view in new tab

    Biological materials

    Mutant

  • BKE08290 ([gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTCATCACTCCCGATA, downstream forward: _UP4_GTGCAGCAAAAGGAGAGTTT
  • BKK08290 ([gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTCATCACTCCCGATA, downstream forward: _UP4_GTGCAGCAAAAGGAGAGTTT
  • References

  • 10094672,8973323,26647299,28461449