SubtiBank SubtiBank
lnrJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lnrJ

two-component sensor kinase, involved in resistance to linearmycin
locus
BSU_08290
pI
6.39
mw
44.38 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
function
involved in resistance to linearmycin
product
two-component sensor kinase
essential
no
synonyms
yfiJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    903,811 905,013

    The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|387EF370CE24F7A3C20789A57329A02EBED46F53|LnrK]
  • [SW|Domains]

  • 5 transmembrane segments
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]-[gene|387EF370CE24F7A3C20789A57329A02EBED46F53|lnrK]
    description
    [Pubmed|8973323]
    view in new tab

    Biological materials

    Mutant

  • BKE08290 ([gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTCATCACTCCCGATA, downstream forward: _UP4_GTGCAGCAAAAGGAGAGTTT
  • BKK08290 ([gene|03AEADB134F1CAD8BBB3E1F625D597EBA1FDA30B|lnrJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGCTCATCACTCCCGATA, downstream forward: _UP4_GTGCAGCAAAAGGAGAGTTT
  • References

  • 10094672,8973323,26647299,28461449