SubtiBank SubtiBank
yfmL
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yfmL

DEAD-box RNA helicase
locus
BSU_07430
pI
9.60
mw
42.03 kDa
protein length
376 aa Sequence Blast
gene length
1131 bp Sequence Blast
function
RNA helicase
product
DEAD-box RNA helicase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.2|RNA synthesis and degradation] → [category|SW 3.2.3|DEAD-box RNA helicases]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.6|Ribosome assembly]
  • Gene

    Coordinates
    816,113 817,243

    Phenotypes of a mutant

  • poor growth at low temperatures (16 to 20C) [Pubmed|23175651]
  • The protein

    Catalyzed reaction/ biological activity

  • RNA helicase
  • required for [SW|ribosome] assembly [Pubmed|23175651]
  • ATP + H2O --> ADP + H+ + phosphate (according to UniProt)
  • Protein family

  • [SW|helicase family] (according to UniProt)
  • [SW|DEAD-box RNA helicases] (according to UniProt)
  • Paralogous protein(s)

  • [protein|C83BD80DE0FD187D07B914F64696438ED5130107|CshB], [protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA], [protein|EACD0C84AA3CE41EF05EAA3D25AA1153293EB562|DeaD]
  • [SW|Domains]

  • [SW|Helicase ATP-binding domain] (aa 35-205) (according to UniProt)
  • [SW|Helicase C-terminal domain] (aa 231-374) (according to UniProt)
  • Structure

  • [PDB|5IVL] ([protein|E169F9711635457EA65FA71CCE9D7FF29DD8DF02|CshA], 87% coverage, 35% identity) [Pubmed|28238534]
  • Expression and Regulation

    Operons

    genes
    [gene|0362D937D985846AEE4D0DEA57B62F915E8D35E5|yfmL]
    description
    [pubmed|22383849]

    regulation

  • expression declines in the stationary phase [Pubmed|23175651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C239 ([gene|0362D937D985846AEE4D0DEA57B62F915E8D35E5|yfmL]::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2237 NBRP B. subtilis, Japan]
  • GP1053 ([gene|0362D937D985846AEE4D0DEA57B62F915E8D35E5|yfmL]::erm), available in the [SW|Jörg Stülke]'s lab [pubmed|23175651]
  • BKE07430 ([gene|0362D937D985846AEE4D0DEA57B62F915E8D35E5|yfmL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCTCCTCAATTC, downstream forward: _UP4_TAAAAAGAAGGGCGAAGAGC
  • BKK07430 ([gene|0362D937D985846AEE4D0DEA57B62F915E8D35E5|yfmL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGTTCTCCTCAATTC, downstream forward: _UP4_TAAAAAGAAGGGCGAAGAGC
  • Expression vectors

  • for expression/ purification from ''B. subtilis'' with C-terminal Strep-tag, for [SW|SPINE], expression from the native chromomsomal site: GP1069 (spc), available in [SW|Jörg Stülke]'s lab
  • GFP fusion

  • B. subtilis GP1082 yfmL-yfp spc, available in [SW|Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|20572937]
  • FLAG-tag construct

  • GP1066 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References

  • 23175651,28238534,30337909