SubtiBank SubtiBank
sirA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sirA

[category|SW 4.2|Sporulation] protein, inhibits [category|SW 3.1.1|DNA replication] initiation in cells committed to [category|SW 4.2|Sporulation], facilitates capture of oriC in the forespore
locus
BSU_17900
pI
7.35
mw
18.00 kDa
protein length
148 aa Sequence Blast
gene length
447 bp Sequence Blast
function
control of chromosome copy number
product
inhibitor of [category|SW 3.1.1|DNA replication]
essential
no
synonyms
yneE,yoxF

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
  • Gene

    Coordinates
    1,922,017 1,922,463

    Phenotypes of a mutant

  • over-replication during [category|SW 4.2|Sporulation] [Pubmed|19682252]
  • defective in oriC segregation during [category|SW 4.2|Sporulation] [pubmed|27489185]
  • The protein

    Catalyzed reaction/ biological activity

  • interacts with domain I of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] and displaces it from the replication origin, resulting in inhibition of replication [Pubmed|19682252]
  • interacts with domain III of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA] to facilitate [protein|5B3DB5A796ACA48390278E60478DFF13D0074A8D|ParA]-dependent oriC capture in the forespore [pubmed|27489185]
  • Structure

  • [PDB|4TPS] (in complex with N-terminal domain of [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]) [Pubmed|25041308]
  • [SW|Localization]

  • accumulates at the [SW|replisome] in sporulating cells (perhaps in [protein|6740108089F13116F200C15F35C2E7561E990FEB|DnaA]-dependent manner) [Pubmed|25041308]
  • Expression and Regulation

    Operons

    genes
    [gene|03595BF6DB8AE79604A720A5BD85C0DB781EE306|sirA]-[gene|9C151A07F22920F58D635B82545DA76C7087AA8E|yneF]
    description
    [Pubmed|9068642]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647,19329632], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647,19329632]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B389 (yneE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1388 NBRP B. subtilis, Japan]
  • BKE17900 ([gene|03595BF6DB8AE79604A720A5BD85C0DB781EE306|sirA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCATCCCCTTTTC, downstream forward: _UP4_TAAAACCGAAGAAAAAGAGA
  • BKK17900 ([gene|03595BF6DB8AE79604A720A5BD85C0DB781EE306|sirA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTTCATCCCCTTTTC, downstream forward: _UP4_TAAAACCGAAGAAAAAGAGA
  • References

    Reviews

  • 20157337,22933559,28075389
  • Original publications

  • 19682252,21239581,14651647,19329632,9068642,25041308,27489185,30285297