SubtiBank SubtiBank
sco
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

sco

accessory lipoprotein required for assembly of the Cu(A) center of [protein|72D5442C0EF3B404F7B615366E357B68C863CEB6|cytochrome c oxidase caa3]
locus
BSU_21750
pI
4.81
mw
21.50 kDa
protein length
193 aa Sequence Blast
gene length
582 bp Sequence Blast
function
maturation of [protein|72D5442C0EF3B404F7B615366E357B68C863CEB6|cytochrome c oxidase caa3]
product
synthesis of cytochrome oxidase protein
essential
no
synonyms
ypmQ

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.1|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,291,703 2,292,284

    The protein

    Catalyzed reaction/ biological activity

  • electron transfer to the maturing oxidase [protein|72D5442C0EF3B404F7B615366E357B68C863CEB6|cytochrome c oxidase caa3] [Pubmed|19921776]
  • Protein family

  • SCO1/2 family (single member, according to UniProt)
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 26-191) (according to UniProt)
  • [SW|Cofactors]

  • contains copper bound by two cysteines and a histidine residue [Pubmed|19921776]
  • Structure

  • [PDB|1XZO] [pubmed|15723536]
  • [SW|Localization]

  • cell membrane [Pubmed|19921776]
  • Expression and Regulation

    Operons

    genes
    [gene|0337C7B1CFA1C59710A7E6463A370F8C39AAC8EA|sco]-[gene|4722C78DB10289939145BDD079661021160C688C|ypmR]-[gene|6E668E7BCD26FCC9873D538385DAF851D7CEC8FC|ypmS]-[gene|3EDC7B00A30AA32E0F8D4FB40011A4BF08B1AB18|ypmT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A882 (ypmQ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/882 NBRP B. subtilis, Japan]
  • BKE21750 ([gene|0337C7B1CFA1C59710A7E6463A370F8C39AAC8EA|sco]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACATCCATCCTTTCCA, downstream forward: _UP4_TAAGCTAAGAGACTAGGCAT
  • BKK21750 ([gene|0337C7B1CFA1C59710A7E6463A370F8C39AAC8EA|sco]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACATCCATCCTTTCCA, downstream forward: _UP4_TAAGCTAAGAGACTAGGCAT
  • References

  • 14680962,14766920,16305244,19027886,10837475,19921776,20232870,21333651,21945854,22036877,25192666,21069401,15723536,29131589,12832793,29676768