SubtiBank SubtiBank
vmlR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

vmlR

F-type ATP-binding cassette protein, allosterically dissociates antibiotics (virginiamycin M, lincomycin) from their ribosomal binding sites
locus
BSU05610
pI
6.73
mw
62.57 kDa
protein length
547 aa Sequence Blast
gene length
1644 bp Sequence Blast
function
dissociation of antibiotics (virginiamycin M, lincomycin) from the ribosome
product
ABCF ATPase
essential
no
synonyms
expZ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • Gene

    Coordinates
    604,736 606,379

    The protein

    Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|ABCF ATPase subfamily] [pubmed|30597160]
  • Structure

  • [PDB|6HA8] [pubmed|30126986]
  • [SW|Localization]

  • cytoplasm [pubmed|30597160]
  • Expression and Regulation

    Operons

    genes
    [gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]
    description
    [Pubmed|16109936]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16109936], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|RNA switch|RNA switch]: , in [regulon|RNA switch|RNA switch]
  • regulation

  • induced by virginiamycin M or lincomycin [Pubmed|16109936]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|vmlR]' and '[protein|search|ydgF]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C159 (expZ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2157 NBRP B. subtilis, Japan]
  • BKE05610 ([gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATATCCCTCGCTTTA, downstream forward: _UP4_TGAGGGAGAAAGTTCAAGCG
  • BKK05610 ([gene|032BF9280D006DD6D7C7D07A983C95E1433AC88C|vmlR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCATATCCCTCGCTTTA, downstream forward: _UP4_TGAGGGAGAAAGTTCAAGCG
  • References

    Reviews

  • 30746819
  • Original publications

  • 10092453,16109936,20525796,24687494,27120414,24389466,30126986,30597160