SubtiBank SubtiBank
hisD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

hisD

histidinol dehydrogenase
locus
BSU34910
pI
4.78
mw
46.09 kDa
protein length
427 aa Sequence Blast
gene length
1284 bp Sequence Blast
function
biosynthesis of histidine
product
histidinol dehydrogenase
essential
no
ec
1.1.1.23
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.14|Biosynthesis/ acquisition of histidine]
  • Gene

    Coordinates
    3,586,271 3,587,554

    The protein

    Catalyzed reaction/ biological activity

  • L-histidinol + 2 NAD+ = L-histidine + 2 NADH (according to Swiss-Prot)
  • Protein family

  • histidinol dehydrogenase family (according to Swiss-Prot)
  • Structure

  • [PDB|1KAH] (with product and NAD from ''Escherichia coli'', 39% identity, 58% similarity) [Pubmed|11842181]
  • Expression and Regulation

    Operons

    genes
    [gene|E8FD92F48BE16F87D7481262F4E49003A78DE78F|hisZ]-[gene|183C8B4F28E601D670B3D997D333AF2B5C4A4759|hisG]-[gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]-[gene|88ED20DFEBD5D7B985F99D4494142FBA699A1E91|hisB]-[gene|DEB3122A3EA36545759FAA6F86F71F971CA5F011|hisH]-[gene|148F0C7983250F50676D234DB713E532AA55DDBF|hisA]-[gene|C22C15754859B2510E52622E6A5DFAF97A7AD4E5|hisF]-[gene|5C84CA2A9E22173E144F519389F545F107A267D9|hisI]
    description
    [Pubmed|12107147]

    regulatory mechanism

  • [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR]: regulation, [pubmed|30355672], in [regulon|F4097349A563503468A2A14F062AEAC532C7917A|YlxR regulon]
  • regulation

  • expression during spore [SW|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
  • expression depends on functional [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials

    Mutant

  • BKE34910 ([gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTCCGCTGATGGTTTTGA, downstream forward: _UP4_GCGAGAGAACGGAGGATTTC
  • BKK34910 ([gene|03274B80B2DFE0A2939981B0E0CB8C34A9B0B102|hisD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTCCGCTGATGGTTTTGA, downstream forward: _UP4_GCGAGAGAACGGAGGATTTC
  • References

  • 12107147,27766092