SubtiBank SubtiBank
yobO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yobO

similar to phage-related pre-neck appendage protein
locus
BSU_19030
pI
5.57
mw
87.55 kDa
protein length
806 aa Sequence Blast
gene length
2421 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    2,076,206 2,078,626

    The protein

    Structure

  • [PDB|3SUC] (from phage Phi29, 40% identity) [pubmed|19450535]
  • Expression and Regulation

    Operons

    genes
    [gene|02269068E6E4282A32BB5AE0FAE27F104202E5B5|yobN]-[gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • subject to carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [Pubmed|10666464]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A312 (yobO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/312 NBRP B. subtilis, Japan]
  • BKE19030 ([gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAGACACCTCTTT, downstream forward: _UP4_TAGTGGATACGCCGACCAGT
  • BKK19030 ([gene|032110CBA492D54F6494984323D12D719EAEAAD9|yobO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTAAAGACACCTCTTT, downstream forward: _UP4_TAGTGGATACGCCGACCAGT
  • References

  • 20817675,10666464,19450535