SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component sensor kinase, control of pyruvate utilization
64.68 kDa
protein length
593 aa Sequence Blast
gene length
1782 bp Sequence Blast
control of pyruvate utilization
two-component sensor kinase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW|Autolysis]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    2,956,486 2,958,267

    Phenotypes of a mutant

  • no growth with pyruvate as the single carbon source [Pubmed|27422364]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + [protein|search|L-histidine] --> ADP + [protein|search|N-phospho-L-histidine] (according to UniProt)
  • [SW|Domains]

  • 5 transmembrane regions
  • [SW|GAF domain] (aa 238-363) (according to UniProt)
  • [SW|Histidine kinase domain] (aa 363-580) (according to UniProt)
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • membrane (putative, due to presence of 5 membrane-spanning domains, according to Uniprot)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-A015 (lytS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE28930 ([gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATGTCACCTGTTCTT, downstream forward: _UP4_GAACATGCTCAGGGTGTTAA
  • BKK28930 ([gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATGTCACCTGTTCTT, downstream forward: _UP4_GAACATGCTCAGGGTGTTAA
  • References


  • 29208748,29354650
  • Original publications

  • 10094672,27422364,28974613