SubtiBank SubtiBank
lytS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lytS

two-component sensor kinase, control of pyruvate utilization
locus
BSU_28930
pI
8.24
mw
64.68 kDa
protein length
593 aa Sequence Blast
gene length
1782 bp Sequence Blast
function
control of pyruvate utilization
product
two-component sensor kinase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.3|Cell wall degradation/ turnover] → [category|SW 1.1.3.1|Autolysis]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.1|Two-component sensor kinase]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,956,486 2,958,267

    Phenotypes of a mutant

  • no growth with pyruvate as the single carbon source [Pubmed|27422364]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + [protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT] = ADP + [protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT]-P
  • [SW|Domains]

  • 5 transmembrane regions
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • membrane (putative, due to presence of 5 membrane-spanning domains, according to Uniprot)
  • Expression and Regulation

    Operons

    genes
    [gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]-[gene|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|lytT]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A015 (lytS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/15 NBRP B. subtilis, Japan]
  • BKE28930 ([gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATGTCACCTGTTCTT, downstream forward: _UP4_GAACATGCTCAGGGTGTTAA
  • BKK28930 ([gene|02FAD7D3A73CC0462D0116F4E5BA9505CBF7FCDD|lytS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATGTCACCTGTTCTT, downstream forward: _UP4_GAACATGCTCAGGGTGTTAA
  • References

    Reviews

  • 29208748,29354650
  • Original publications

  • 10094672,27422364,28974613