SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


diaminopimelate decarboxylase
48.41 kDa
protein length
439 aa Sequence Blast
gene length
1317 bp Sequence Blast
biosynthesis of lysine
diaminopimelate decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    2,436,947 → 2,438,266

    Phenotypes of a mutant

  • auxotrophic for lysine [Pubmed|15574923]
  • reduced conjugation of ICEBs1 [Pubmed|25069588]
  • The protein

    Catalyzed reaction/ biological activity

  • H+ + meso-2,6-diaminopimelate --> CO2 + L-lysine (according to UniProt)
  • Protein family

  • Orn/Lys/Arg decarboxylase class-II family (single member, according to UniProt)
  • [SW|Cofactors]

  • PLP (according to UniProt)
  • Structure

  • [PDB|1HKW] (from ''Mycobacterium tuberculosis'', 42% identity, 61% similarity) [Pubmed|12637582]
  • Expression and Regulation



    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,1903432], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT]: activation, [Pubmed|8755877], in [regulon|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|SpoVT regulon]
  • regulation

  • expressed late during sporulation in the forespore ([protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], [SW|SpoVT]) [Pubmed|15699190,1903432,8755877]
  • view in new tab

    view in new tab

    Biological materials


  • 1A615 ( ''lysA''::''erm''), [Pubmed|3015878], available at [ BGSC]
  • BKE23380 (Δ[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATTCCCTCTTTCT, downstream forward: _UP4_TAAAAGAAAGCGCCGATTTT
  • BKK23380 (Δ[gene|02F1C926D200DE85C93A0ACEF23AD25FBD12B0BD|lysA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGTCATTCCCTCTTTCT, downstream forward: _UP4_TAAAAGAAAGCGCCGATTTT
  • References

  • 7934830,15574923,15699190,1903432,8755877,25069588