SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


xanthine phosphoribosyltransferase
20.89 kDa
protein length
194 aa Sequence Blast
gene length
585 bp Sequence Blast
purine salvage and interconversion
xanthine phosphoribosyltransferase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW|Purine salvage and interconversion]
  • Gene

    2,319,440 2,320,024

    The protein

    Catalyzed reaction/ biological activity

  • diphosphate + XMP --> 5-phospho-α-D-ribose 1-diphosphate + xanthine (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Structure

  • [PDB|1Y0B], [PDB|2FXV] (complex with GMP), [PDB|1Y27] (the riboswitch in complex with guanine)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [PubMed|17981983]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9098051], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|G-box|G-box]: termination, [SW|riboswitch] [Pubmed|9098051,12787499], in [regulon|G-box|G-box]
  • [protein|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR]: repression, (molecular inducer: PRPP) [Pubmed|11591660], in [regulon|A8C82F5825DE0921DA6B4ACDE0CC31EC7749273C|PurR regulon]
  • regulation

  • induced in the absence of guanine ([SW|G-box]) [Pubmed|12787499]
  • view in new tab

    Biological materials


  • MGNA-A870 (xpt::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE22070 ([gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGTCTACCTCCGTTA, downstream forward: _UP4_TCCTTCGTACAGGAGGTTCA
  • BKK22070 ([gene|02C84C9A8C0008CC253CBF13584A4B5B2D2B510C|xpt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCTGTCTACCTCCGTTA, downstream forward: _UP4_TCCTTCGTACAGGAGGTTCA
  • lacZ fusion

  • pGP430 (in [SW|pAC7]), available in [SW|Jörg Stülke]'s lab
  • References

  • 16716072,9098051,12923093,15629952,11591660,15610857,20200045,11591660,20204714,26704707,27941758,28541183,28798404