SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


2-oxoglutarate dehydrogenase complex (dihydrolipoamide transsuccinylase, E2 subunit)
45.83 kDa
protein length
417 aa Sequence Blast
gene length
1254 bp Sequence Blast
TCA cycle
2-oxoglutarate dehydrogenase complex

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|TCA cycle]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    2,107,505 2,108,758

    The protein

    Catalyzed reaction/ biological activity

  • (R)-N6-dihydrolipoyl-L-lysyl-[2-oxoglutarate dehydrogenase complex component E2] + succinyl-CoA --> (R)-N6-(S8-succinyldihydrolipoyl)-L-lysyl-[2-oxoglutarate dehydrogenase complex component E2] + CoA (according to UniProt)
  • Protein family

  • [SW|2-oxoacid dehydrogenase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|262C9FD20C7A70B6F1FEB57735FA800F38EAB25A|BkdB], [protein|2F40086E35FA32136B9A89C530A86D714FE9460C|PdhC], [protein|C4B6C3EE560C8BD353FEABB1A607C89C20DC8D34|AcoC]
  • [SW|Domains]

  • [SW|Lipoyl-binding domain] (aa 1-76) (according to UniProt)
  • [SW|Peripheral subunit-binding domain] (PSBD) (aa 123-160) (according to UniProt)
  • Modification

  • phosphorylated on several Arg residues [Pubmed|24263382]
  • [SW|Cofactors]

  • lipoic acid (on Lys-42), can be removed by [protein|A0A6CB19191A251BB5600C18E039978A9A34933C|SrtN] [pubmed|28900027]
  • Structure

  • [PDB|3DUF] (EI of the PDH complex from ''Geobacillus stearothermophilus'', 38% identity) [Pubmed|19081062]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Additional information

  • extensive information on the structure and enzymatic properties of 2-oxoglutarate dehydrogenase can be found at [ Proteopedia]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1508153], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose (2.4-fold) ([protein|search|CcpA]) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • GP1276 Δ(''[gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])''::''cat'', available in [SW|Jörg Stülke]'s lab [Pubmed|24178028]
  • GP2332 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • GP2334 Δ([gene|3B54AD8514709655BA829347B7BD5B38EF7C08ED|odhA]-[gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB])::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [SW|Jörg Stülke]'s lab
  • BKE19360 ([gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCGCCATTTTTTCATTTC, downstream forward: _UP4_TAATAAAAAAGGGTACATCA
  • BKK19360 ([gene|02BA02D10DFB06E51101D8CF76BCF5BED94D7CA2|odhB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCGCCATTTTTTCATTTC, downstream forward: _UP4_TAATAAAAAAGGGTACATCA
  • Expression vectors

  • pGP1145 (N-terminal Strep-tag, for [SW|SPINE], purification from ''B. subtilis'', in [SW|pGP380]) (available in [SW|Stülke] lab) [Pubmed|20933603]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Stülke] lab [Pubmed|20933603]
  • FLAG-tag construct

  • GP1424 (spc, based on [SW|pGP1331]), available in the [SW|Stülke] lab
  • References


  • 10672230,27074917
  • Original publications

  • 2500417,1508153,12850135,18763711,12682299,11976317,20933603,24178028,24263382,28900027,19081062,31066113