SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


macrolide glycosyltransferase
43.83 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
synthesis of bacillaene
macrolide glycosyltransferase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    1,292,557 1,293,735

    The protein

    Protein family

  • UDP-glycosyltransferase family (with [protein|BD82663B1BF2763D2D2DE710C2896E4155419324|YdhE] and [protein|6D808BC20ADB6CA789288D50CA816D6BEE22CFC3|YojK], according to UniProt)
  • Structure

  • [PDB|2IYA] (from Streptomyces antibioticus, 37% identity) [pubmed|17376874]
  • Expression and Regulation



    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|26577401]
  • view in new tab

    Biological materials


  • MGNA-A345 (yjiC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12220 ([gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTCCAGTCTCCTT, downstream forward: _UP4_TAAAAACATAAAAACCGAAA
  • BKK12220 ([gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTCCAGTCTCCTT, downstream forward: _UP4_TAAAAACATAAAAACCGAAA
  • References

  • 25354260,28315700,17376874,29338263