SubtiBank SubtiBank
yjiC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjiC

macrolide glycosyltransferase
locus
BSU12220
pI
4.65
mw
43.83 kDa
protein length
392 aa Sequence Blast
gene length
1179 bp Sequence Blast
function
synthesis of bacillaene
product
macrolide glycosyltransferase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.14|Resistance against toxins/ antibiotics/ based on similarity]
  • Gene

    Coordinates
    1,292,557 1,293,735

    The protein

    Protein family

  • UDP-glycosyltransferase family (according to Swiss-Prot)
  • Structure

  • [PDB|2IYA] (from Streptomyces antibioticus, 37% identity) [pubmed|17376874]
  • Expression and Regulation

    Operons

    genes
    [gene|D8E72C2523D5E6214C9CBAC2C1B27EA45378E162|yjiB]-[gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [pubmed|26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [pubmed|26577401]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A345 (yjiC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/345 NBRP B. subtilis, Japan]
  • BKE12220 ([gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTCCAGTCTCCTT, downstream forward: _UP4_TAAAAACATAAAAACCGAAA
  • BKK12220 ([gene|02927D2CC9F44B99DB307DDFED2DD52DE2196120|yjiC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAATCTCCAGTCTCCTT, downstream forward: _UP4_TAAAAACATAAAAACCGAAA
  • References

  • 25354260,28315700,17376874,29338263