SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


c-di-GMP degrading phosphodiesterase
47.76 kDa
protein length
409 aa Sequence Blast
gene length
1230 bp Sequence Blast
degradation of c-di-GMP
c-di-GMP degrading phosphodiesterase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.3|Metabolism of signalling nucleotides]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • Gene

    3,258,037 3,259,266

    Phenotypes of a mutant

  • about three-fold increase of intracellular levels of c-di-GMP [pubmed|31138629]
  • The protein

    Catalyzed reaction/ biological activity

  • degradation of c-di-GMP [Pubmed|23893111]
  • [SW|Domains]

  • contains an EAL domain [Pubmed|22821967]
  • EAL domain (aa 1-209) (according to UniProt)
  • HDOD domain (aa 203-392) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647,15687200]
  • view in new tab

    Biological materials


  • MGNA-A606 (yufA/yuxH::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1590 (kan) available in [SW|Jörg Stülke]'s lab
  • BKE31740 ([gene|02628F274952F9AEEE9F2224B771A4CE4AAD1C8D|pdeH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTATCCCCCTTAC, downstream forward: _UP4_TATTTAGAGGCTCTGGAATG
  • BKK31740 ([gene|02628F274952F9AEEE9F2224B771A4CE4AAD1C8D|pdeH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGATTTATCCCCCTTAC, downstream forward: _UP4_TATTTAGAGGCTCTGGAATG
  • References

  • 14651647,15687200,2507523,22821967,23893111,31138629