SubtiBank SubtiBank
yisI

yisI

[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P phosphatase, control of the [SW|phosphorelay]
locus
BSU_10730
pI
5.12
mw
6.54 kDa
protein length
gene length
171 bp Sequence Blast
function
control of [SW|sporulation] initiation
product
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]-P phosphatase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.7|phosphorelay] → [category|SW 3.4.7.5|Phosphatases controlling the phosphorelay]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.2|phosphorelay] → [category|SW 4.2.2.5|Phosphatases controlling the phosphorelay]
  • Gene

    Coordinates
    1,150,850 1,151,020

    The protein

    Protein family

  • spo0E family (with [protein|search|ynzd ]and [protein|A574974B6F4FF46DC69E03AE021651C67089866F|Spo0E], according to UniProt)
  • Structure

  • [PDB|2C0S] (from B. anthracis, corresponds to aa 1 ... 41 of YisI, 44% identity) [pubmed|17001075]
  • Expression and Regulation

    Operons

    genes
    [gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]: activation, in [regulon|0D555F2AB7DC863E6FF388888308E980514DB719|PchR regulon]
  • view in new tab

    genes
    [gene|75FBA935A39AF67DB4E69C8699D29D9F5C149143|yisJ]-[gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]
    description
    [Pubmed|22383849]

    regulation

  • induced during [SW|sporulation] [Pubmed|22383849]
  • strongly expressed during oligotrophic growth [pubmed|30792386]
  • view in new tab

    Biological materials

    Mutant

  • BKE10730 ([gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTATCTCCAATTC, downstream forward: _UP4_TAAATCATTTTCTATAACAA
  • BKK10730 ([gene|022933D89666CDD2ACE39BCBB78D349BAF8E899B|yisI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTACGCTATCTCCAATTC, downstream forward: _UP4_TAAATCATTTTCTATAACAA
  • References

  • 11679073,20525796,27542896,17001075