SubtiBank SubtiBank
ykzD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ykzD

unknown
locus
BSU_13290
pI
4.19
mw
5.28 kDa
protein length
gene length
138 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,395,371 1,395,508

    Expression and Regulation

    Operons

    genes
    [gene|0219624A8C4BC3394E2EF8A38C90E265DF04EF77|ykzD]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [pubmed|30782632], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE13290 ([gene|0219624A8C4BC3394E2EF8A38C90E265DF04EF77|ykzD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGTTTCGCCTCCTTTT, downstream forward: _UP4_TAAGGGCTTAGGCCCTTGTT
  • BKK13290 ([gene|0219624A8C4BC3394E2EF8A38C90E265DF04EF77|ykzD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGTTTCGCCTCCTTTT, downstream forward: _UP4_TAAGGGCTTAGGCCCTTGTT
  • References

    Research papers

  • 30782632