SubtiBank SubtiBank
spoVT [2019-07-29 11:25:27]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

spoVT [2019-07-29 11:25:27]

transcription activator and repressor of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]-dependent genes
19.60 kDa
protein length
178 aa Sequence Blast
gene length
537 bp Sequence Blast
regulation of forespore gene expression
transcriptional regulator

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    64,099 64,635

    The protein

    Paralogous protein(s)

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]:
  • Structure

  • [PDB|2W1R] (full-length), [PDB|2W1T] (C-terminal domain) [PDB|2RO5] (recognition domain)
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|15699190,8755877], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed in the forespore ([protein|search|SigG]) [Pubmed|8755877]
  • view in new tab

    view in new tab

    Biological materials


  • BKE00560 ([gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGGTGCCTCTCTTT, downstream forward: _UP4_TAGGTCTTATTCCTTTCTTC
  • BKK00560 ([gene|01EF886D3D004EA9B22AC5E75D50FF07D8631E68|spoVT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCTGGTGCCTCTCTTT, downstream forward: _UP4_TAGGTCTTATTCCTTTCTTC
  • References

  • 16497325,18996130,15063493,8755877,16479537,16159768,22522895,15980461,27790204