SubtiBank SubtiBank
ydbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydbD

general stress protein, similar to manganese-containing catalase
locus
BSU_04430
pI
4.86
mw
30.11 kDa
protein length
273 aa Sequence Blast
gene length
822 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.9|Resistance against oxidative and electrophile stress/ based on similarity]
  • Gene

    Coordinates
    495,740 496,561

    The protein

    Catalyzed reaction/ biological activity

  • 2 H2O2 --> O2 + 2 H2O (according to UniProt)
  • Protein family

  • [SW|catalase family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|59EC45E8731FE989152553A69ACEF6569E88F85C|YjqC], [protein|8F21A4C6228A772B38597991AF43E6B0708339BF|CotJC]
  • Structure

  • [PDB|1JKU] (from Lactobacillus plantarum, 51% identity) [pubmed|11587647]
  • Expression and Regulation

    Operons

    genes
    [gene|7428E80AC67A659B8602AF887EA7DFFD4976B40C|dctB]-[gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]
    description
    [Pubmed|10708364]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    genes
    [gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]

    regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • BKE04430 ([gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACCCATCTCCTTTTT, downstream forward: _UP4_TAAAGAGACAAGCCCAAAAC
  • BKK04430 ([gene|01CE4BBBEB0C0855201D396FB8036F72B64EA7DD|ydbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTACCCATCTCCTTTTT, downstream forward: _UP4_TAAAGAGACAAGCCCAAAAC
  • References

  • 15805528,10708364,11587647