SubtiBank SubtiBank
yjgD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjgD

general stress protein, survival of ethanol and paraquat stresses
locus
BSU_12170
pI
6.72
mw
21.13 kDa
protein length
186 aa Sequence Blast
gene length
561 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    1,288,541 1,289,101

    Expression and Regulation

    Operons

    genes
    [gene|E54F39E72DC4881E886159607C2B424A41DE0D01|yjgC]-[gene|01C43D05A53BF4B0F505D9C9CCAAFA1AF9E94F87|yjgD]
    description
    [Pubmed|11544224]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|11544224,15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A377 (yjgD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/377 NBRP B. subtilis, Japan]
  • BKE12170 ([gene|01C43D05A53BF4B0F505D9C9CCAAFA1AF9E94F87|yjgD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTTTTTGGATTCGTTTAA, downstream forward: _UP4_TGACCTCCCACCCGAGCGGC
  • BKK12170 ([gene|01C43D05A53BF4B0F505D9C9CCAAFA1AF9E94F87|yjgD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12170 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GATTTTTTGGATTCGTTTAA, downstream forward: _UP4_TGACCTCCCACCCGAGCGGC
  • References

  • 15805528,11544224,22582280