SubtiBank SubtiBank
yjfA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjfA

unknown
locus
BSU_12110
pI
9.49
mw
16.74 kDa
protein length
157 aa Sequence Blast
gene length
474 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    1,282,571 1,283,044

    The protein

    [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|01AC4E8F76170E04A215C20EB6E833D3661EA49F|yjfA]
    description
    [Pubmed|12480901]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|12480901,15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|12480901,15699190]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A346 (yjfA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/346 NBRP B. subtilis, Japan]
  • BKE12110 ([gene|01AC4E8F76170E04A215C20EB6E833D3661EA49F|yjfA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTATGACCTCCTTAAT, downstream forward: _UP4_TAAATAGAAAAAAGGCTGTC
  • BKK12110 ([gene|01AC4E8F76170E04A215C20EB6E833D3661EA49F|yjfA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTTATGACCTCCTTAAT, downstream forward: _UP4_TAAATAGAAAAAAGGCTGTC
  • References

  • 18957862,12480901,15699190