SubtiBank SubtiBank
pyrE
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

pyrE

orotate phosphoribosyltransferase
locus
BSU_15560
pI
5.63
mw
23.38 kDa
protein length
216 aa Sequence Blast
gene length
651 bp Sequence Blast
function
pyrimidine biosynthesis
product
orotate phosphoribosyltransferase
essential
no
ec
2.4.2.10
synonyms
pyrX

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.5|Nucleotide metabolism] → [category|SW 2.5.2|Biosynthesis/ acquisition of nucleotides] → [category|SW 2.5.2.4|Biosynthesis/ acquisition of pyrimidine nucleotides]
  • Gene

    Coordinates
    1,629,320 1,629,970

    The protein

    Catalyzed reaction/ biological activity

  • diphosphate + orotidine 5'-phosphate --> 5-phospho-α-D-ribose 1-diphosphate + orotate (according to UniProt)
  • Protein family

  • [SW|Purine/pyrimidine phosphoribosyltransferase family] (according to UniProt)
  • Structure

  • [PDB|3DEZ] (from ''Streptococcus mutans'', 59% identity, 74% similarity)
  • Expression and Regulation

    Operons

    genes
    [gene|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|pyrR]-[gene|A5C26E10085868A0A193C450DF58D54C636B7C2D|pyrP]-[gene|B83462A50FDDD20FE9BD4681824E30AAD10F506B|pyrB]-[gene|CA16FD3507DCCADB1E01DF25B42C3405C9205B05|pyrC]-[gene|E7741ED6F15044900BDC5F0584246469D2D4D586|pyrAA]-[gene|D57DC8A53E52BC4A2EA894E3C9FD983592882918|pyrAB]-[gene|C20A05AE4CE8AEE0DA767334935CC64106A7FCCB|pyrK]-[gene|E533BEF28579CD04B24E2C728737269E35224450|pyrD]-[gene|5D0D0D2413377FCA92440334E92B5A27A5963D9E|pyrF]-[gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]
    description
    [Pubmed|8206849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|1709162], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR]: termination/ antitermination, via [SW|RNA switch], in [regulon|6D9CEDC7737CCFA838EBC142CD735E066C950AD2|PyrR regulon]
  • regulation

  • induced in the absence of uridine nucleotides ([protein|search|PyrR]) [Pubmed|8206849]
  • view in new tab

    Biological materials

    Mutant

  • BKE15560 ([gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGATGTTTTGCGATGATTT, downstream forward: _UP4_TAAAAAATAAATTCAAATGA
  • BKK15560 ([gene|0197A037D2AF049B295E1DA60187D4614B2BAC51|pyrE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15560 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TAGATGTTTTGCGATGATTT, downstream forward: _UP4_TAAAAAATAAATTCAAATGA
  • References

  • 8206849,1709162