SubtiBank SubtiBank
pfeT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pfeT

Fe2+ efflux pump, P1B4-type ATPase, protects the cell against iron intoxication
locus
BSU_13850
pI
4.93
mw
68.39 kDa
protein length
637 aa Sequence Blast
gene length
1914 bp Sequence Blast
function
protection against toxic iron
product
Fe2+ efflux pump
essential
no
ec
3.6.3.5
synonyms
ykvW,zosA

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.5|Metal ion transporter]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.5|Iron metabolism] → [category|SW 2.6.5.6|Iron export]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,451,371 1,453,284

    Phenotypes of a mutant

  • sensitivity to iron, this can be suppressed by low levels of Mn2+ [Pubmed|26261021]
  • reduced genetic competence, can be rescued by the addition of excess zinc [Pubmed|21813502]
  • reduced expression of [gene|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|comK], control is exerted at the post-transcriptional level and can be rescued by the addition of excess zinc [Pubmed|21813502]
  • The protein

    Catalyzed reaction/ biological activity

  • ATP + H2O + Zn2+ --> ADP + H+ + phosphate + Zn2+ (according to UniProt)
  • P-type zinc-transporting ATPase [Pubmed|12180919]
  • Protein family

  • [SW|cation transport ATPase (P-type) (TC 3.A.3) family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|5BC6B02770E74FF6D453742832574A87BB2369B8|CadA], [protein|727024F7B1AC19676ED4B516CF46A47B1328310B|CopA]
  • Structure

  • [PDB|4UMV] (zinc transporter from Shigella sonnei, 39% identity) [pubmed|25132545]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]
    description
    [Pubmed|12180919]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12180919], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|22194458,12180919], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, [pubmed|22194458], in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • regulation

  • induced by hydrogen peroxide ([protein|D0982500E52577D52FADF775C0E512A4B9657B79|AhpC]) [Pubmed|12180919]
  • induced by iron excess ([protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]) [pubmed|22194458]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|0B299F9459023306FA91298A6162A09E4A87C3B2|StoA]' and '[protein|017A57F27DD8E515242FB658A61E74C1D58273CC|PfeT]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B329 (ykvW::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1328 NBRP B. subtilis, Japan]
  • BKE13850 ([gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAATTCTCCTCTCT, downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
  • BKK13850 ([gene|017A57F27DD8E515242FB658A61E74C1D58273CC|pfeT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13850 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATCGAATTCTCCTCTCT, downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
  • References

    Reviews

  • 28604884
  • Original publications

  • 14563870,12426338,12486061,12180919,12779235,21813502,12180919,12180919,20525796,26261021,26566138,25132545,22194458