SubtiBank SubtiBank
yuxO
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuxO

similar to thioesterase
locus
BSU_31670
pI
6.47
mw
13.64 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
srfB

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,252,405 3,252,785

    The protein

    Protein family

  • thioesterase PaaI family (single member, according to UniProt)
  • Structure

  • [PDB|4QD8] (from Pseudomonas aeruginosa, 45% identity) [pubmed|]
  • Expression and Regulation

    Operons

    genes
    [gene|FDACEF9DDC3BEA4EB013AE67BC47ADA532F00205|comQ]-[gene|60D6EB02923D9ADE88F61A8CBBD882BA8BDD457E|comX]-[gene|5A00E233F0B5A0DAB18D2ECC55527F1911987F86|comP]-[gene|7832489F11F606BCF637EC23BAAB41AD10237EBB|comA]-[gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2507523], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B560 (yuxO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1559 NBRP B. subtilis, Japan]
  • BKE31670 ([gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCCATCTCTACACCCCCCA, downstream forward: _UP4_TAAAAAAACAGCCGGAACTC
  • BKK31670 ([gene|015989AAB862E418C944AB35DA3605863F059CE9|yuxO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCCATCTCTACACCCCCCA, downstream forward: _UP4_TAAAAAAACAGCCGGAACTC
  • References

  • 2507523