SubtiBank SubtiBank
csfB
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

csfB

anti-sigma factor, inhibitor of [protein|search|SigG ]and of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
locus
BSU_00240
pI
7.67
mw
7.30 kDa
protein length
gene length
195 bp Sequence Blast
function
control of [protein|search|SigG ]and [protein|search|SigE ]activity
product
inhibitor of [protein|search|SigG ]and [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
essential
no
synonyms
gin,yaaM

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    35,531 35,725

    Phenotypes of a mutant

  • premature activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] [Pubmed|17921305]
  • The protein

    Catalyzed reaction/ biological activity

  • inhibitor of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] and [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] [pubmed|29526435,17921305,19497328]
  • [SW|Cofactors]

  • Zn2+ [pubmed|29526435]
  • Structure

  • [PDB|5N7Y] [pubmed|29526435]
  • [SW|Localization]

  • forespore and mother cell [Pubmed|25835496]
  • Expression and Regulation

    Operons

    genes
    [gene|01412FA454DDBA12622E3B32C433F8059123661B|csfB]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|25835496], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulation

  • expressed after completion of forespore engulfment in the mother cell ([protein|search|SigK]) [Pubmed|25835496]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B894 (yaaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1893 NBRP B. subtilis, Japan]
  • BKE00240 ([gene|01412FA454DDBA12622E3B32C433F8059123661B|csfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE00240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTCCACCTCCGTAC, downstream forward: _UP4_TAGACCTGAAAAGGTCTTTT
  • BKK00240 ([gene|01412FA454DDBA12622E3B32C433F8059123661B|csfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK00240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTCTCCACCTCCGTAC, downstream forward: _UP4_TAGACCTGAAAAGGTCTTTT
  • References

    Reviews

  • 31350897
  • Original Publications

  • 7592342,19497328,8759874,18208527,16497325,17921305,20802044,21935351,25835496,22383849,26929302,29526435