SubtiBank SubtiBank
yycB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yycB

similar to permeases
locus
BSU_40480
pI
10.50
mw
43.02 kDa
protein length
402 aa Sequence Blast
gene length
1209 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    4,159,790 4,160,998

    The protein

    Protein family

  • [SW|major facilitator superfamily] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1CB229DE87D56674903A8348657FA3B3117FEADD|yycC]-[gene|00F319EEC8420F859BA2657B9D4D1281853A94BD|yycB]
    description
    [Pubmed|12823818]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|search|TnrA]) [Pubmed|12823818]
  • view in new tab

    genes
    [gene|1CB229DE87D56674903A8348657FA3B3117FEADD|yycC]-[gene|00F319EEC8420F859BA2657B9D4D1281853A94BD|yycB]-[gene|CFEA05E10517C00222126F959A1D2DCE7604E478|yycA]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]: repression, [Pubmed|12823818], in [regulon|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA regulon]
  • regulation

  • repressed in the absence of good nitrogen sources (glutamine or ammonium) ([protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|TnrA]) [Pubmed|12823818]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B832 (yycB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1831 NBRP B. subtilis, Japan]
  • BKE40480 ([gene|00F319EEC8420F859BA2657B9D4D1281853A94BD|yycB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGTTACTCCTCTTT, downstream forward: _UP4_TAAAGCGGGGAAGATATCTC
  • BKK40480 ([gene|00F319EEC8420F859BA2657B9D4D1281853A94BD|yycB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAAGCAGTTACTCCTCTTT, downstream forward: _UP4_TAAAGCGGGGAAGATATCTC
  • References

  • 12823818,25755103