SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


component of the [protein|search|SpoIIIA]-[protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] type III secretion system residing in the forespore membrane, required for [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG] activation
23.58 kDa
protein length
218 aa Sequence Blast
gene length
657 bp Sequence Blast
activation of [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG], forespore encasement by the spore coat
part of the transmembrane channel linking the mother cell and the forespore

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.5|Protein secretion]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,532,353 2,533,009

    Phenotypes of a mutant

  • reduced sporulation efficiency (1 to 10% compared to wild type) [Pubmed|26735940]
  • the ''[gene|8F3751A3D0910C9BED7FBCE90AFF7FDACFDCBC0B|spoIIIL] [gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]'' double mutant has a severe sporulation defect (0.001%) [Pubmed|26735940]
  • block of sporulation after engulfment
  • The protein

    Catalyzed reaction/ biological activity

  • required for forespore encasement by the spore coat [Pubmed|22171814]
  • Structure

  • [PDB|3UZO]; [PDB|3TUF] (the [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]-[protein|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|SpoIIIAH] pore forming complex) [Pubmed|22431604,22431613]
  • [SW|Localization]

  • membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ]) [Pubmed|22431604,22431613,22171814,18485064]
  • proper recruitment to the sporulation septum on the mother cell side requires [protein|3282D2C25468776881778006F182FCF322C4821D|SpoIIQ] [Pubmed|23834622]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,18485064], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, [Pubmed|15383836], in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • regulation

  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab



  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab



  • both promoters: expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|18485064], switched off by [SW|SpoIIID] [Pubmed|15383836]
  • additional information

  • the internal promoter is essential for sporulation, it is twice as active as the promoter in front of [protein|search|spoIIIAA], suggesting that [protein|search|SpoIIIAG] and [protein|search|SpoIIIAH] are required in larger amounts as compared to the other products of the operon [ PubMed]
  • view in new tab

    Biological materials


  • BKE24360 ([gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGC
  • BKK24360 ([gene|00BDD4E3370DB3A9F4D75FE265A2A8DF05185CCC|spoIIIAH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGC
  • labs

  • [SW|Charles Moran], Emory University, NC, USA [ homepage]
  • References


  • 23944268,25105965,31350897
  • Original publications

  • 15752199,18485064,15574594,18812514,1766372,17693505,19609349,17121846,21097616,22431613,22171814,23834622,22431604,23859254,25356555,26735940,27381174,27681621