SubtiBank SubtiBank
perR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

perR

transcriptional repressor of the peroxide regulon, sensor of the intracellular Fe/Mn ratio
locus
BSU08730
pI
5.89
mw
16.28 kDa
protein length
145 aa Sequence Blast
gene length
438 bp Sequence Blast
function
regulation of the response to peroxide
product
transcriptional repressor ([SW|Fur family])
essential
no
synonyms
ygaG

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • Gene

    Coordinates
    944,487 944,924

    Phenotypes of a mutant

  • resistant to hydrogen peroxide, accumulates a porphyrin-like compound, and grows very slowly (due to heme sequestration by [protein|B0A1AB6E920E6CBEE45115297599AF9A80972E38|KatA]) [Pubmed|22194458]
  • The protein

    Protein family

  • [SW|Fur family]
  • Paralogous protein(s)

  • [protein|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|Zur], [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]
  • Modification

  • selective metal catalyzed oxidation of two histidine residues of the regulatory site results in induction (loss of DNA-binding activity) [Pubmed|19508285]
  • [SW|Cofactors]

  • contains an Fe2+ at the regulatory site and Zn2+ [Pubmed|22797754]
  • Effectors of protein activity

  • responds to the presence of hydrogen peroxide [pubmed|29738773]
  • Structure

  • [PDB|2RGV] [PDB|3F8N]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]
    description
    [Pubmed|12029044]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|12029044], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR]: repression, [Pubmed|12029044], in [regulon|00BCAAE16576DC5426A652580C69A570FC7A1C2C|PerR regulon]
  • regulation

  • induced in the presence of hydrogen peroxide ([protein|search|PerR]) [Pubmed|12029044]
  • view in new tab

    genes
    [gene|3C139835154FA236066CF2FB82A3C32E3A72D65E|ygaF]-[gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • GP3171 [gene|00BCAAE16576DC5426A652580C69A570FC7A1C2C|perR]::kan trpC2 available in [SW|Jörg Stülke]'s lab
  • MGNA-A258 (ygaG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/258 NBRP B. subtilis, Japan]
  • HB0509 (spc), available in [SW|John Helmann]'s and [SW|Jörg Stülke]'s labs, also GP868 (''fur::mls'', ''perR::spc'').
  • 1A903 ( ''perR''::''kan''), [Pubmed|12029044], available at the [http://bgsc.org/getdetail.php?bgscid=1A903 Bacillus Genetic Stock Center]
  • BKE08730 ([gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC
  • BKK08730 ([gene|D0982500E52577D52FADF775C0E512A4B9657B79|ahpC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08730 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCCGTCATGCACCTCTCT, downstream forward: _UP4_TAAAAATAAGCTGACCGCAC
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

    Reviews

  • 19575568,19508286,20094649,20977351,22797754,25160631,26070785,26677871,28938859
  • Original Publications

  • 8932315,18487332,14563870,16766519,17158660,12486061,11532148,12180919,16166527,15231799,12029044,10913706,21398634,9701813,16541078,12029044,11532148,12029044,19508285,22194458,23645680,23057863,23934352,25486128,26261021,27920297,27935957,28104400,11918677,29738773