SubtiBank SubtiBank
yvbI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yvbI

unknown
locus
BSU_33870
pI
7.76
mw
25.61 kDa
protein length
232 aa Sequence Blast
gene length
699 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,473,372 3,474,070

    Phenotypes of a mutant

  • increased conjugation of ICEBs1 [Pubmed|25069588]
  • The protein

    [SW|Localization]

  • cell membrane (according to UniProt), membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|00A6C1AD9D27E900133E0F9007C76E1812C3A2AA|yvbI]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A460 (yvbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/460 NBRP B. subtilis, Japan]
  • BKE33870 ([gene|00A6C1AD9D27E900133E0F9007C76E1812C3A2AA|yvbI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATAACTCCTTTATC, downstream forward: _UP4_TAAAAACAACCCCATCACCT
  • BKK33870 ([gene|00A6C1AD9D27E900133E0F9007C76E1812C3A2AA|yvbI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33870 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATAACTCCTTTATC, downstream forward: _UP4_TAAAAACAACCCCATCACCT
  • References

  • 18763711,22383849,25069588,26577401