SubtiBank SubtiBank
yezB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yezB

split paralog of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] (with [protein|778B0E3A524EFE38DE3917FA69F21563D525D1DA|YetI])
locus
BSU_07180
pI
0.00
mw
0.00 kDa
protein length
gene length
297 bp Sequence Blast
function
possible stressosome protein
product
split paralog of [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR] (with [protein|778B0E3A524EFE38DE3917FA69F21563D525D1DA|YetI])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    787,264 → 787,560

    The protein

    [SW|Domains]

  • [SW|STAS domain] (according to InterPro)
  • Modification

  • phosphorylated on Ser/ Thr by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|PrkC], dephosphorylated by [protein|84447F9A6644EA8A7593BB99B2B69D4377E670E2|PrpC] [Pubmed|19246764]
  • Structure

  • [PDB|2MWG] ([protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], corresponds to aa 17 ... 83 of YezB, 36% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|778B0E3A524EFE38DE3917FA69F21563D525D1DA|yetI]-[gene|00A19F2D960FAD4A6DA34D027828E1135A3BE218|yezB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE07180 (Δ[gene|00A19F2D960FAD4A6DA34D027828E1135A3BE218|yezB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGGACCGGCACTGTTTCTA, downstream forward: _UP4_TAGGAAGTTTCCAGGCATAT
  • BKK07180 (Δ[gene|00A19F2D960FAD4A6DA34D027828E1135A3BE218|yezB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07180 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCGGACCGGCACTGTTTCTA, downstream forward: _UP4_TAGGAAGTTTCCAGGCATAT
  • References

  • 19246764,19246764