SubtiBank SubtiBank
ydzS/2
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydzS/2

part of the ydzS pseudogene
locus
BSU_05344
pI
0.00
mw
0.00 kDa
protein length
gene length
114 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms
Outlinks

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    581,341 581,454

    Expression and Regulation

    Operons

    genes
    [gene|D169C58739F17EE0D341D015592FF07CBBE1B6E1|aseR]-[gene|C0E921ECAEE12DEC32A5DEE866762D6971360FA1|aseA]-[gene|6BA4A8575050B1BA45FF98E1F3B1F27F6C24A5E4|ydzS/1]-[gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]: repression, [Pubmed|15948947], in [regulon|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR regulon]
  • regulation

  • induced by As(III) ([protein|D169C58739F17EE0D341D015592FF07CBBE1B6E1|AseR]) [Pubmed|15948947]
  • view in new tab

    Biological materials

    Mutant

  • BKE05344 ([gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05344 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTGACAGCACTCGATG, downstream forward: _UP4_TGATGAAATTGGTGACCGTT
  • BKK05344 ([gene|009BB4460A9374A8259DE7BD05724467198E0A90|ydzS/2]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05344 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCTTTGACAGCACTCGATG, downstream forward: _UP4_TGATGAAATTGGTGACCGTT