SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


13.43 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,884,968 1,885,321

    Biological materials


  • BKE17540 ([gene|0088EB2863FEC9E911332A8D9CDEB91D2A574FFA|ynaF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGTTTCAATAACCG, downstream forward: _UP4_TAAATAAAACTACTATTTTT
  • BKK17540 ([gene|0088EB2863FEC9E911332A8D9CDEB91D2A574FFA|ynaF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGTTTCAATAACCG, downstream forward: _UP4_TAAATAAAACTACTATTTTT