SubtiBank SubtiBank
ynaF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ynaF

unknown
locus
BSU_17540
pI
4.01
mw
13.43 kDa
protein length
117 aa Sequence Blast
gene length
354 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,884,968 1,885,321

    Biological materials

    Mutant

  • BKE17540 ([gene|0088EB2863FEC9E911332A8D9CDEB91D2A574FFA|ynaF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGTTTCAATAACCG, downstream forward: _UP4_TAAATAAAACTACTATTTTT
  • BKK17540 ([gene|0088EB2863FEC9E911332A8D9CDEB91D2A574FFA|ynaF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17540 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTAGTTTCAATAACCG, downstream forward: _UP4_TAAATAAAACTACTATTTTT