SubtiBank SubtiBank
yabD [2018-03-02 18:22:01]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yabD [2018-03-02 18:22:01]

29.08 kDa
protein length
255 aa Sequence Blast
gene length
765 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    47,706 → 48,473

    The protein

    Protein family

  • tatD DNase family (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element including an intrinsic transcription terminator upstream of [gene|DCBDD135F295B04FE7C7EB92E94638701CB320DD|metS] [Pubmed|27120414]
  • view in new tab

    Biological materials


  • MGNA-B904 (yabD::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE00390 (Δ[gene|00798BB5A769C464CC5FDDF7D9E41D30B473B9A8|yabD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTGAAAAACTCCTTT, downstream forward: _UP4_TGACAAAAAACGCTAGCGGG
  • BKK00390 (Δ[gene|00798BB5A769C464CC5FDDF7D9E41D30B473B9A8|yabD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAGTGAAAAACTCCTTT, downstream forward: _UP4_TGACAAAAAACGCTAGCGGG
  • References

  • 10747959