SubtiBank SubtiBank
ybbC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ybbC

unknown
locus
BSU_01650
pI
7.37
mw
45.87 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yzbB

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    185,194 186,438

    The protein

    Structure

  • [PDB|4K05] (from Bacteroides fragilis, 43% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|0B1F43F43A4DC1574A153DBFBAA5D0A1855F9B61|murQ]-[gene|125872506C400CB6B3DAEA8B5130B064DFBA4494|murR]-[gene|178D5E2AA1225FE909E6F2B63B3595F5ABB8E7A2|murP]-[gene|DEACFD435DB01C4B3ADEF397BEE08E2E7C7FCC36|amiE]-[gene|A5D4BF262BD365DCEBA9358C8DB295E605DE4D84|nagZ]-[gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials

    Mutant

  • BKE01650 ([gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE01650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTCTCATGTGTCCCT, downstream forward: _UP4_TAGAACATAAGCATCGTATG
  • BKK01650 ([gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK01650 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTCTCATGTGTCCCT, downstream forward: _UP4_TAGAACATAAGCATCGTATG
  • References

  • 22383849,30038046