SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


45.87 kDa
protein length
414 aa Sequence Blast
gene length
1245 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    185,194 186,438

    The protein


  • [PDB|4K05] (from Bacteroides fragilis, 43% identity)
  • Expression and Regulation



    regulatory mechanism

  • [protein|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR]: repression, [pubmed|30038046], in [regulon|125872506C400CB6B3DAEA8B5130B064DFBA4494|MurR regulon]
  • regulation

  • expressed in late exponential and early stationary phase [Pubmed|20400549]
  • view in new tab

    Biological materials


  • BKE01650 ([gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTCTCATGTGTCCCT, downstream forward: _UP4_TAGAACATAAGCATCGTATG
  • BKK01650 ([gene|005D37F34CA3D6891F7D8FF7A2AFA1CBCB556FFE|ybbC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTTTTCTCATGTGTCCCT, downstream forward: _UP4_TAGAACATAAGCATCGTATG
  • References

  • 22383849,30038046