SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


nicotinate transporter
43.55 kDa
protein length
400 aa Sequence Blast
gene length
1203 bp Sequence Blast
uptake of niacin
nicotinate transporter

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW|Transporter for cofactors]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis of NAD(P)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    317,725 318,927

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • The protein

    Protein family

  • [SW|major facilitator superfamily] [Pubmed|18276644]
  • [SW|Sugar transporter (TC 2.A.1.1) family] (according to UniProt)
  • [SW|Domains]

  • 10 membrane-spanning domains [Pubmed|18276644]
  • Structure

  • [PDB|4J05] (from ''P. indica'', 24% identity) [Pubmed|23542591]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation



    regulatory mechanism

  • [protein|510DE075EA964D22C42DEB171509F6CDA600A402|NadR]: repression, [Pubmed|18276644], in [regulon|510DE075EA964D22C42DEB171509F6CDA600A402|NadR regulon]
  • regulation

  • repressed in the presence of nicotinic acid ([protein|search|NadR]) [Pubmed|18276644]
  • view in new tab

    Biological materials


  • MGNA-C047 (yceI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE02950 ([gene|0037A6808E75C2A2E207A7005EFDA71FCE90BAD8|niaP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCAACACCTCTGATA, downstream forward: _UP4_TAGGAAAAGCACCTCTTAAA
  • BKK02950 ([gene|0037A6808E75C2A2E207A7005EFDA71FCE90BAD8|niaP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGCCAACACCTCTGATA, downstream forward: _UP4_TAGGAAAAGCACCTCTTAAA
  • References


  • 21953179
  • Original publications

  • 18763711,18276644,23980836,22383849,23542591