SubtiBank SubtiBank
rqcH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rqcH

ribosome-associated protein quality control factor
locus
BSU15640
pI
8.98
mw
65.30 kDa
protein length
572 aa Sequence Blast
gene length
1719 bp Sequence Blast
function
rescue of stalled ribosomes
product
ribosome-associated protein quality control factor
essential
no
synonyms
yloA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    1,636,131 1,637,849

    Phenotypes of a mutant

  • defective in [SW|biofilm formation] [pubmed|28294433]
  • The protein

    Protein family

  • NEMF family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [pubmed|28294433], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, [pubmed|28294433], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression during logarithmic growth [Pubmed|28294433]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression during stationary phase [Pubmed|28294433]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B371 (yloA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1370 NBRP B. subtilis, Japan]
  • BKE15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT, downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
  • BKK15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT, downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
  • References

  • 28294433,21873635,31155236