SubtiBank SubtiBank


ribosome-associated protein quality control factor
65.30 kDa
protein length
572 aa Sequence Blast
gene length
1719 bp Sequence Blast
rescue of stalled ribosomes
ribosome-associated protein quality control factor

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW|Translation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Other proteins required for biofilm formation]
  • Gene

    1,636,131 1,637,849

    Phenotypes of a mutant

  • defective in [SW|biofilm formation] [pubmed|28294433]
  • The protein

    Protein family

  • NEMF family (single member, according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [pubmed|28294433], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, [pubmed|28294433], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression during logarithmic growth [Pubmed|28294433]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression during stationary phase [Pubmed|28294433]
  • view in new tab

    Biological materials


  • MGNA-B371 (yloA::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT, downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
  • BKK15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT, downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
  • References

  • 28294433,21873635,31155236