SubtiBank SubtiBank
rqcH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rqcH

ribosome-associated protein quality control factor
locus
BSU_15640
pI
8.98
mw
65.30 kDa
protein length
572 aa Sequence Blast
gene length
1719 bp Sequence Blast
function
rescue of stalled ribosomes
product
ribosome-associated protein quality control factor
essential
no
synonyms
yloA

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.5|Other proteins required for biofilm formation]
  • Gene

    Coordinates
    1,636,131 1,637,849

    Phenotypes of a mutant

  • defective in [SW|biofilm formation] [pubmed|28294433]
  • The protein

    Protein family

  • NEMF family (single member, according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [pubmed|28294433], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, [pubmed|28294433], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression during logarithmic growth [Pubmed|28294433]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression during stationary phase [Pubmed|28294433]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B371 (yloA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1370 NBRP B. subtilis, Japan]
  • BKE15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT, downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
  • BKK15640 ([gene|003047E90159765F9F0E499FD760F95FFF4AC360|rqcH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACACCCTCTCATTCTT, downstream forward: _UP4_TGAGCCGCATAAAGAAAAGC
  • References

  • 28294433,21873635,31155236